Menu
Sanger Sequencing is performed on an Applied Biosystems 3730 Genetic Analyzer, a 48 capillary electrophoresis instrument for DNA sequencing or DNA fragment analysis. For full service sequencing, users provide templates and primers in separate tubes and we perform the sequencing reactions using Applied Biosystem’s BigDye version 3.1. Some users choose to perform their own sequencing reactions and therefore provide dried “load only” reactions for sequencing at a discounted price. There is a further discount for “load only” reactions delivered in 96-well trays.
For DNA Templates:
We provide the commonly used plasmid primers:
M13Fwd (-20) – GTAAAACGACGGCCAGTG
M13Rev – AGGAAACAGCTATGACCATG
T7 promoter – TAATACGACTCACTATAGGG
T7 terminator – GCTAGTTATTGCTCAGCGG
SP6 – ATTTAGGTGACACTATAG
The current price for Eurofins Sanger sequencing is $4.00/tube or $3.00/well for 96-well plates. Eurofins offers >70 universal sequencing primers for free with your sequencing order. Shipping is also free. Results (.seq and .ab1 files) will be returned the next day before noon, including on Saturday.
Drop box locations:
DNAStar is a powerful bioinformatics software package that provides sequence analysis, cloning and primer design as well as next-gen sequencing, gene expression, RNA-Seq, ChIP-Seq, and transcriptome analyses. This software is paid for by the Center for Environmental Biotechnology and the Departments of Microbiology, Ecology and Evolutionary Biology, Biochemistry & Cellular and Molecular Biology, and Genome Science & Technology. Faculty, staff, and students within these departments are provided free access to DNAStar. If other departments or individual labs wish to gain access, please contact Renee Johnson (rdjohns@utk.edu; 865-974-8080) to discuss payment options. Both PC and Mac versions are available. You can download a 14-day trial of DNAStar if you would like to test it before using.
Sanger Sequencing, TapeStation, and Fragment/SNP Analysis
| Services | Internal University of Tennessee User | Eurofins mail-in* | External academic user | External non-academic user |
|---|---|---|---|---|
| Full service sequencing | $11.00 | **$4.00 | $12.00 | $14.00 |
| Full service sequencing 96 well tray | N/A | $3.00 | N/A | N/A |
| Load-Only sequencing | $5.00 | $1.00 | $6.50 | $7.50 |
| Load-Only sequencing 96 well tray | $4.50 | $1.00 | $6.00 | $7.00 |
| Fragment analysis (48 minimum) | $223.00 | N/A | $288.00 | $336.00 |
| DNA Quantification prior to Sanger sequencing | $1.50 | N/A | $2.00 | $3.00 |
| TapeStation standard sensitivity | $5.00 | N/A | $5.50 | $6.00 |
| TapeStation high sensitivity | $6.00 | N/A | $6.50 | $7.00 |
| TapeStation extra ladder | TBD | N/A | TBD | TBD |
| Extra Big Dye | $1.00 | N/A | $1.00 | $1.00 |
| Labor/Training per hour | $49.00 | N/A | $74.00 | $81.00 |
*Eurofins offers a variety of other sequencing options. Please download their price sheet for more information.
**Eurofins offers a Power Read service for an additional $2.50/tube for difficult-to-sequence samples (i.e., templates with G/C-rich content, difficult secondary structures, homopolymeric sequences, tandem repeat stretches, bisulfite-treated DNA, shRNA, etc.).
