Skip to content Skip to main navigation Report an accessibility issue

Sanger Sequencing Core Facility

Sanger Sequencing is performed on an Applied Biosystems 3730 Genetic Analyzer, a 48 capillary electrophoresis instrument for DNA sequencing or DNA fragment analysis. For full service sequencing, users provide templates and primers in separate tubes and we perform the sequencing reactions using Applied Biosystem’s BigDye version 3.1. Some users choose to perform their own sequencing reactions and therefore provide dried “load only” reactions for sequencing at a discounted price. There is a further discount for “load only” reactions delivered in 96-well trays.

For DNA templates, 15 ng of DNA is required per 100 base pairs in 12 ul volumes or less. DNA should be eluted in water for best results. For example, a 5 kb plasmid requires 750 ng of template DNA. For a 500 bp PCR product, 75 ng of template are required. Each primer constitutes one reaction, and primers should be provided at 10 uM concentration, 2 uL per reaction. Good quality starting template DNA should provide about 800-1000 bases of good quality sequence.

Electronic sequencing results for Sanger sequencing are sent via email as .ab1 or .seq files. The .seq file is an unedited text file used mostly for blasting into available databases. The .ab1 file is the Applied Biosystems electropherogram (chromatogram) file that is generated using ABI’s Sequencing Analysis Software. The sequence editing software Sequencher (GeneCodes) is available through the Genomics Core for installation on personal computers, allowing you to view, edit, and align multiple sequencing results files.

Samples for Sanger sequencing that are quantified and in the lab by 11:00 am should be processed with results emailed to the client by approximately noon the following day. All other services are performed on a first come, first served basis. The lab is open Monday thru Friday, 8:30AM – 4:30PM and is located in Room 347A of the Ken and Blaire Mossman Building.

We provide the commonly used plasmid primers listed below.

M13Fwd (-20) GTAAAACGACGGCCAGTG
M13Rev AGGAAACAGCTATGACCATG
T7 promoter TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGG
SP6 ATTTAGGTGACACTATAG

We are here to help you! If you have any questions on how to prepare your samples for Sanger sequencing, please contact Joe May at bioseq@utk.edu or 974-6231.

 

Sanger sequencing using Eurofins Genomics (mail-in option at reduced cost)

As an alternative to in-house Sanger sequencing, we also offer drop boxes across campus for those researchers wishing to mail in their samples for sequencing. Samples are mailed overnight to Eurofins Genomics with results returned by, or before, noon the next day. The quality of your results is dependent upon the quality of DNA that you submit to Eurofins, so it is critical that you follow their directions in sample preparation and sample labeling. Please click below for instructions on how to prepare and mail samples to Eurofins Genomics:

Eurofins Genomics ‘How to’ instructions

Eurofins Genomics informational flyer

Eurofins Genomics pricing sheet

The current price for Eurofins Sanger sequencing is $4.00/tube or $3.00/well for 96-well plates. Eurofins offers >70 universal sequencing primers for free with your sequencing order. Shipping is also free. Results (.seq and .ab1 files) will be returned the next day before noon, including on Saturday.

Drop box locations:

  • Room 347A, Ken and Blaire Mossman Building (contact info: Joe May; bioseq@utk.edu; 974-6231)
  • Room 732, Science and Engineering Research Facility (SERF) (contact info: Tingting Xu; txu2@utk.edu; 974-8369)
  • The UTIA Omics Hub Lab, Plant Biotechnology Building, Room 308 (contact info: Sujata Agarwal; sagarwal@utk.edu; 974-0676)

 

Fragment/SNP analysis

Fragment/SNP analysis, such as AFLP, RFLP, and microsatellites, can be processed on the ABI 3730, which can detect five fluorescent colors, allowing for 4 unknowns and a size standard to be run per well. Recommended dye sets include D (3 unknowns per well: 6FAM, HEX, & NED, with ROX size standard) and G5 (4 unknowns per well: 6FAM, VIC, NED, & PET, with LIZ size standard).

The instrument runs 48 samples at a time, and the Core has a minimum billing price of 48 samples. Contact the Core (bioseq@utk.edu or 974-6231) for information on sample preparation.

 

Costs

Sanger Sequencing and Gene Scan Fragment Analysis

Services UT-Clients Eurofins mail-in* Non-UT Academic Commercial
Full service sequencing $6.50 $4.00 $7.50 $8.50
Full service sequencing 96 well tray N/A $3.00 N/A N/A
Load-Only sequencing $4.50 $1.00 $5.50 $6.50
Load-Only sequencing 96 well tray $4.50 $1.00 $5.50 $6.50
Fragment analysis (48 minimum) $4.00 N/A $5.00 $6.00
DNA Quantification $1.00 N/A $1.00 $1.00
Extra Big Dye $1.00 N/A $1.00 $1.00
Labor/Training per hour $44.00 N/A $65.00 $80.00
NOTE: costs subject to change
*Eurofins offers a variety of other sequencing options. Please download their price sheet for more information.

 

Additional Services

The Core provides three different methods of DNA quantification, including the Agilent Bioanalyzer 2100, the Hoefer DynaQuant Fluorometer, and the ThermoScientific Nanodrop. The fluorometer and Nanodrop are available free of charge. Click HERE for costs for using the Agilent Bioanalyzer.